@article{10.11648/j.advances.20220301.15,
  author = {Ismail Muhammad and Pukuma Micah Sale and Augustine Linda Midala},
  title = {Absence of Biomakers of Resistance in K13 Propeller Gene of Plasmodium falciparum from Gombe L.G.A of Gombe State, Nigeria},
  journal = {Advances},
  volume = {3},
  number = {1},
  pages = {25-33},
  doi = {10.11648/j.advances.20220301.15},
  url = {https://doi.org/10.11648/j.advances.20220301.15},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.advances.20220301.15},
  abstract = {Malaria is still one of the life threatening parasitic disease in Sub-Saharan Africa. The causative agent of the disease always provide a means of avoiding the action of most commonly recommended drugs like Artemisinin based Combination Therapy (ACTs) through development of resistance. The aim of this surveillance study was to investigate the status of some biomarkers of Artemisisnin resistance in K13 Propeller gene of Plasmodium falciparum from Gombe L.G.A. Nigeria. 200 blood samples were collected from consented study subjects and analysed using Microscopy, RDT and PCR. DNA was extracted using Quick-DNA™ Miniprep (No. D4069), Purity and Concentration of the DNA was determined using Nanodrop Spectrophotometer. 57 true positive samples were selected and used for molecular analysis. Nested PCR was used to amplify required codon (M442V, N554S, A569S and A578S) portion of K13 the gene. Both Primary and Secondary PCR were carried out in 25µl containing DNA template 5µl, distilled water 6.5µl, 0.5µl each of the forward and reverse primer (F5’GGGAATCTGGTGGTAAACAGC3’ and R5’CGGAGTGACCAAATCTGGGA3’for primary PCR, F5’GCCTTGTTGAAAGAAGCAGA3’ and GCCAAGCTGCCATTCATTTG3’ for Nested PCR) and 12.5µl Master mix. Thermocyclic were set as 95°C for 2minute (initial denaturation), followed by 35 cycles at 95°C for 45seconds denaturation, 57°C for 20s, Annealing 60°C for 150s extension and final extension at 60°C for 10min, while for secondary PCR was 95°C for 1min, followed by 35 cycles at 95°C for 30s, 55°C for 20s, 60°C for 60s and final extension at 60°C for 10minute. The PCR products were subjected to electrophoresis in 2% agarose and stained with ethidium bromide. The amplicons were purified and sequenced, afterwhich the sequenced products were subjected to BLAST software. All the fifty seven sequenced amplicon were found to be wild type. All isolate of Plasmodium falciparum used in the study were sensitive to ACTs from Further research should be carried out using large sample size and also targeting other bio makers of artemisisnin resistance associated with K13.},
 year = {2022}
}

Copy | Download

TY  - JOUR
T1  - Absence of Biomakers of Resistance in K13 Propeller Gene of Plasmodium falciparum from Gombe L.G.A of Gombe State, Nigeria
AU  - Ismail Muhammad
AU  - Pukuma Micah Sale
AU  - Augustine Linda Midala
Y1  - 2022/03/09
PY  - 2022
N1  - https://doi.org/10.11648/j.advances.20220301.15
DO  - 10.11648/j.advances.20220301.15
T2  - Advances
JF  - Advances
JO  - Advances
SP  - 25
EP  - 33
PB  - Science Publishing Group
SN  - 2994-7200
UR  - https://doi.org/10.11648/j.advances.20220301.15
AB  - Malaria is still one of the life threatening parasitic disease in Sub-Saharan Africa. The causative agent of the disease always provide a means of avoiding the action of most commonly recommended drugs like Artemisinin based Combination Therapy (ACTs) through development of resistance. The aim of this surveillance study was to investigate the status of some biomarkers of Artemisisnin resistance in K13 Propeller gene of Plasmodium falciparum from Gombe L.G.A. Nigeria. 200 blood samples were collected from consented study subjects and analysed using Microscopy, RDT and PCR. DNA was extracted using Quick-DNA™ Miniprep (No. D4069), Purity and Concentration of the DNA was determined using Nanodrop Spectrophotometer. 57 true positive samples were selected and used for molecular analysis. Nested PCR was used to amplify required codon (M442V, N554S, A569S and A578S) portion of K13 the gene. Both Primary and Secondary PCR were carried out in 25µl containing DNA template 5µl, distilled water 6.5µl, 0.5µl each of the forward and reverse primer (F5’GGGAATCTGGTGGTAAACAGC3’ and R5’CGGAGTGACCAAATCTGGGA3’for primary PCR, F5’GCCTTGTTGAAAGAAGCAGA3’ and GCCAAGCTGCCATTCATTTG3’ for Nested PCR) and 12.5µl Master mix. Thermocyclic were set as 95°C for 2minute (initial denaturation), followed by 35 cycles at 95°C for 45seconds denaturation, 57°C for 20s, Annealing 60°C for 150s extension and final extension at 60°C for 10min, while for secondary PCR was 95°C for 1min, followed by 35 cycles at 95°C for 30s, 55°C for 20s, 60°C for 60s and final extension at 60°C for 10minute. The PCR products were subjected to electrophoresis in 2% agarose and stained with ethidium bromide. The amplicons were purified and sequenced, afterwhich the sequenced products were subjected to BLAST software. All the fifty seven sequenced amplicon were found to be wild type. All isolate of Plasmodium falciparum used in the study were sensitive to ACTs from Further research should be carried out using large sample size and also targeting other bio makers of artemisisnin resistance associated with K13.
VL  - 3
IS  - 1
ER  - 

Copy | Download